AJCN North Carolina Research Campus
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dedoussis, G. V
Right arrow Articles by Stefanadis, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dedoussis, G. V
Right arrow Articles by Stefanadis, C.
Agricola
Right arrow Articles by Dedoussis, G. V
Right arrow Articles by Stefanadis, C.
American Journal of Clinical Nutrition, Vol. 80, No. 4, 849-854, October 2004
© 2004 American Society for Clinical Nutrition


ORIGINAL RESEARCH COMMUNICATION

Effect of interaction between adherence to a Mediterranean diet and the methylenetetrahydrofolate reductase 677C->T mutation on homocysteine concentrations in healthy adults: the ATTICA Study1,2,3

George V Dedoussis, Demosthenes B Panagiotakos, Christina Chrysohoou, Christos Pitsavos, Antonis Zampelas, Despoina Choumerianou and Christodoulos Stefanadis

1 From the Department of Science in Dietetics and Nutrition, Harokopio University, Athens, Greece (GVD, DBP, AZ, and DC), and the First Cardiology Clinic, School of Medicine, University of Athens, Athens, Greece (CC, CP, and CS)

2 The ATTICA study is supported by research grants from the Hellenic Society of Cardiology.

3 Address reprint requests to DB Panagiotakos, 46 Paleon Polemiston St Glyfada, Attica, 166 74, Greece. E-mail: d.b.panagiotakos{at}usa.net.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: Dietary and genetic factors may influence the effect of raised homocysteine concentrations on coronary artery disease risk.

Objective: We evaluated the effect of the interaction between adoption of a Mediterranean diet and the methylenetetrahydrofolate reductase gene (MTHFR) 677C->T mutation on homocysteine concentrations in healthy adults participating in the ATTICA study.

Design: We studied demographic, lifestyle, clinical, biochemical, and genetic information from 322 men ( ± SD age: 46 ± 13 y) and 252 women (45 ± 14 y) who had no clinical evidence of cardiovascular or any other chronic disease. We also measured total plasma homocysteine concentrations, the distribution of the MTHFR genotype, and adherence to a Mediterranean diet.

Results: The distribution of MTHFR genotypes was as follows: homozygous normal (CC), 41%; heterozygous (CT), 48%; and homozygous mutant (TT), 11%. Homocysteine concentrations were higher in persons with the TT genotype than in those with the CC and CT genotypes ( ± SD: 15.8 ± 9 compared with 11.3 ± 8 and 10.8 ± 9 µmol/L, respectively; P < 0.001). The Mediterranean diet score was not significantly associated with homocysteine concentrations (P = 0.89). However, after control for potential confounders, the stratified analysis showed that adherence to a Mediterranean diet was associated with reduced homocysteine concentrations in persons with the TT and CT genotypes (ß = –0.21, P = 0.002, and ß = –0.14, P = 0.025, respectively) but not in those with the CC genotype (ß = –0.03, P = 0.38).

Conclusion: The observed association of an MTHFR 677C->T gene–diet interaction on homocysteine concentrations may provide a pathophysiologic explanation for how a Mediterranean diet may influence coronary risk in persons with raised homocysteine concentrations.

Key Words: Homocysteine • methylenetetrahydrofolate reductase • MTHFR genotype • cardiovascular disease • Mediterranean diet


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Several investigators consider raised total homocysteine (tHcy) concentrations to be an independent risk factor for cardiovascular disease, and the involvement of tHcy in mechanisms of thrombosis is well documented (13). Moreover, other studies suggest that an elevated plasma tHcy concentration substantially increases the risk associated with some of the conventional cardiovascular disease risk factors (4, 5). However, some findings do not confirm or recognize tHcy importance in actually causing coronary artery disease, and some studies have considered tHcy more as a result than as a cause of arteriosclerosis, especially as a result of the confounding effect of various nutrient and genetic factors (68). The C-to-T substitution at nucleotide 677 (677C->T mutation), which leads to the exchange of an alanine for a valine in the gene encoding 5,10-methylenetetrahydrofolate reductase (MTHFR; OMIM.236350), results in a thermolabile variant of MTHFR that produces a partially defective enzyme (9). The mutation is present in the TT form in 12% of whites (10). MTHFR activity regulates 5-methyltetrahydrofolate, which is required for the re-methylation of tHcy to methionine and S-adenosylmethionine, the common methyl donor for the maintenance of DNA methylation. In particular, raised tHcy concentrations have been related to homozygous MTHFR 677T, especially in the presence of low folate concentrations (11, 12). However, note that plasma tHcy concentrations may increase as a result of nutritional deficiencies in essential cofactors or enzyme substrates, including vitamin B-12, folate, and vitamin B-6.

Several carefully studied populations in Mediterranean countries and in some areas in Asia, where traditional diets consist largely of foods of plant origin, exhibit low rates of many chronic diseases and long life expectancies. Many case-control and prospective studies have provided further evidence that high consumption of plant foods confers numerous health benefits. Although the mechanisms are not fully understood, carotenoids, folic acid, and fiber, all of which are abundant in the Mediterranean diet, appear to play important roles in the prevention of coronary artery disease (13).

Even though the effect of folic acid, vitamin B-6, and vitamin B-12 on plasma tHcy concentrations is well established, the association of a Mediterranean diet as a whole on tHcy is not known. In addition, the presence of MTHFR genotypes that differentiate tHcy concentrations may influence the relation between a Mediterranean diet and tHcy. Thus, we sought to evaluate the association of a gene-diet interaction between adoption of a Mediterranean diet and the MTHFR 677C->T mutation on tHcy concentrations in healthy adults from the ATTICA study.


    SUBJECTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Nomenclature
The gene symbols used in this article follow the recommendations of the HUGO Gene Nomenclature Committee (14).

Study population
The ATTICA study (15) is a health and nutrition survey that is being carried out in the province of Attica (including 78% urban and 22% rural areas), where Athens is the major metropolis. The sampling was random, multistage, and based on the age and sex distribution of the province of Attica provided by the National Statistical Service (census of 2001). The participation rate was 68%. From the initial sample, we excluded 10% of men and 7% of women with history of chronic disease (renal failure, liver and cardiovascular disease, and chronic obstructive pulmonary disease) and individuals ({approx}2%) who reported current or chronic use of certain drugs that influence tHcy concentrations, such as methotrexate, trimethoprin, cholestyramine, and cyclosporine. Also, all persons living in institutions were excluded. All participants were interviewed by trained personnel (cardiologists, dietitians, and nurses) who used a standard questionnaire. The study was approved by the Medical Research Ethics Committee and was carried out in accordance with the Declaration of Helsinki (1989) of the World Health Organization.

MTHFR genotype analysis
DNA was isolated from peripheral leukocytes by using the Gentra DNA isolation kit (Gentra Systems Inc, Minneapolis). According to a previously described procedure (9), genotyping for the MTHFR point polymorphism 677C->T was performed by polymerase chain reaction amplification with the primers 5TGAAGGAGAAGGTGTCTGCGGGA3 (sense) and 5AGGACGGTGCGGTGAGAGTG3 (antisense). Thirty cycles (95 °C for 45 s, 64 °C for 30 s, and 72 °C for 30 s) were used to amplify the 198–base pair (bp) product. Because the C-to-T transition at nucleotide 677 produces a HinfI digestion site, the amplified product derived from the mutant gene was cleaved into 175-bp and 23-bp fragments by HinfI, which leaves the wild-type gene unaffected. After electrophoresis through a 6%-polyacrylamide gel, the digestion products were visualized by staining with ethidium bromide.

Biochemical analysis
Blood samples were collected from the antecubital vein between 0800 and 1000 while the subjects were sitting and after they had fasted and avoided consuming alcohol and coffee for 12 h. The blood for measuring tHcy was collected in frozen vials containing 3.5% EDTA (by vol) and was stored on ice for <30 min until centrifuged (1800 cycles/min for 15 min). The biochemical analysis was carried out by following the criteria of the World Health Organization Lipid Reference Laboratories. The concentration of tHcy in plasma was estimated by using an automatic analyzer (Abott Axsym; Diamond Diagnostics, Holliston, MA) based on the technology of fluorescence polarization immunoassay (16). Serum total cholesterol was measured by using a chromatographic enzymatic method in a Technicon automatic analyzer RA-1000 (Dade Boehringer, Mannheim, Germany). An internal quality control was in place for assessing the validity of the cholesterol methods. The intra- and interassay CVs for cholesterol concentrations did not exceed 4%.

Dietary assessment
Consumption of unrefined cereals and products, bread and other grains, vegetables, legumes, fruit and juices, olive oil, dairy products, fish, pulses, nuts, potatoes, eggs, sweets, poultry, red meat, and meat products was measured as averages per week over the past year through the use of a validated food-frequency questionnaire according to the guidelines of the Unit of Nutrition of our institution. The frequency of consumption was then quantified approximately in terms of the number of times per month a food was consumed. All participants were asked about their usual frequency of consumption of coffee (in mL/d) over the past year. All reported types of coffee (instant coffee, Greek type, filtered, and cappuccino) were adjusted for one cup of 150 mL and a concentration of 27 g caffeine per 100 mL. We also took into account the consumption of decaffeinated coffee, tea, and caffeine-containing drinks (cola) and of chocolate. Alcohol consumption was measured as daily ethanol intake in wine glasses of 100 mL (adjusted for an ethanol content of 12 g). A Harvard-led group with substantial input from Greek scientists suggested a dietary pyramid that illustrates the components of the Mediterranean diet (17). On the basis of this dietary pyramid, we calculated a special diet score (ranging from 0 to 55) that assessed adherence to a Mediterranean diet. Details about the development of this score may be found elsewhere (15). Higher values of the suggested dietary score indicate adherence to the traditional Mediterranean diet, whereas lower values indicate adherence to a westernized diet.

Demographic, clinical, and lifestyle characteristics
The study's questionnaire also included demographic characteristics such as age, sex, average annual income during the past 3 y (in Euros), and education level (in years of school). Information about smoking habits was collected by using a standardized questionnaire developed for the study. Current smokers were defined as those who smoked at least one cigarette per day. Former smokers were defined as those who had stopped smoking more than one year previously. The rest of the participants were defined as never smokers. For the multivariate statistical analyses, cigarette smoking was quantified in pack-years (number of cigarette packs smoked per day x years of smoking), adjusted for a nicotine content of 0.8 mg per cigarette. Physical activity was defined as leisure-time activity of a certain intensity and duration, at least once per week during the past year, and was graded in qualitative terms such as light (expended calories <4 kcal/min), moderate (expended calories 4–7 kcal/min), and vigorous (expended calories >7 kcal/min). The rest of the subjects were defined as physically inactive. Body mass index was calculated as weight (in kilograms) divided by standing height (in meters squared). Obesity was defined as a body mass index >29.9. Waist and hip circumferences were also measured in all participants.

Arterial blood pressure was measured 3 times on the right arm (ELKA aneroid sphygmomanometer; Von Schlieben Co, Frankfurt, Germany) at the end of the physical examination with the subject in a sitting position for ≥30 min. The patients whose average blood pressure was ≥140/90 mm Hg or who were taking antihypertensive medication were classified as having hypertension. Hypercholesterolemia was defined as a total serum cholesterol concentration >220 mg/dL or the use of lipid-lowering agents, and diabetes mellitus was defined as a blood sugar concentration >125 mg/dL or the use of antidiabetic medication.

Statistical analysis
A statistical power calculation (EAST 3, 2003; Cytel Software Corporation, Cambridge, MA) showed that the number of studied participants was adequate to evaluate >0.5 two-tailed standardized differences in tHcy concentrations between MTHFR genotypes. In particular, we achieved statistical power equal to 0.84 at a probability level <0.05.

Continuous variables are presented as means ± SDs, whereas qualitative variables are presented as absolute and relative frequencies. Associations between genotype distributions and other categorical variables were tested by the use of contingency tables and the calculation of chi-square tests. Comparisons between continuous variables and categorical variables were performed by the calculation of Student's t test. The normal distribution of the investigated variables was assessed through the Kolmogorov-Smirnov criterion. In all analyses, we used the log transformation for the dietary score because of its skewed distribution. Correlations between tHcy concentrations and age, smoking habits (in pack-years), and body mass index were evaluated by calculation of Pearson's correlation coefficient and those with the dietary score by Spearman's rho coefficient. Differences in tHcy concentrations between genotypes and other subgroups of the participants were tested by using multi-way analysis of covariance and the corresponding multiple linear regression models, after taking into account the effects of age, sex, body mass index, smoking and dietary habits, physical activity level, medication use, and education status as well as their interactions. The models' validity was tested by plotting jackknife residuals against fitted values. Additionally, jackknife residuals were used to find any outliers or influential points in the data. Then we introduced alternatively the variables representing the various food groups into the core regression model that also included several characteristics of the participants. Thus, we assessed the effect of qualitative aspects of nutrition on tHcy concentrations.

All reported P values are based on two-sided tests and were compared with a significance level of 5%. Because of multiple comparisons, we used Bonferroni's correction to account for the increase in type I error. The STATISTICAL PACKAGE FOR SOCIAL SCIENCES, version 11.0 (SPSS Inc, Chicago) was used for all statistical calculations.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characteristics of the participants
tHcy concentrations were higher in the men than in the women (13 ± 4 compared with 10 ± 5 µmol/L; P = 0.001). The demographic, clinical, and behavioral characteristics of the participants according to tHcy concentration are presented in Table 1Go, for men and women separately. Current smoking, prevalence of obesity, hypertension, and diabetes mellitus were positively associated with tHcy concentrations in men, whereas age, smoking, prevalence of hypertension, and diabetes were positively associated with tHcy concentrations in women.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Characteristics of the study's participants according to total homocysteine (tHcy) concentration1

 
Distribution of MTHFR 677C->T polymorphism
The distribution of the MTHFR genotypes in our population was compatible with the Hardy-Weinberg equilibrium (P = 0.8). The T allele frequency was 35%, and the CC, CT, and TT genotype frequencies were 41% (n = 235), 48% (n = 276), and 11% (n = 63), respectively. The T allele frequency in our sample was similar to that in other white populations. The MTHFR genotypes were similarly distributed in men and women (in men, CC: 42%, CT: 48%, TT: 10%, and in women, CC: 41%, CT: 48%, TT: 11%; P = 0.97).

No significant differences existed between participants with TT and non-TT genotypes regarding age (45 ± 12 and 46 ± 11 y; P = 0.67), prevalence of smoking habits (52% and 54%; P = 0.77), hypertension (36% and 39%; P = 0.57), hypercholesterolemia (43% and 44%; P = 0.87), and diabetes (8% and 9%; P = 0.83).

Homocysteine concentrations and MTHFR genotype
tHcy concentrations were higher in men with the TT genotype than in those with the CC or CT genotype (19 ± 7, 12 ± 8, and 11 ± 9 µmol/L, respectively; Bonferroni corrected P < 0.01); the same trend was found in the women (14 ± 7, 9 ± 7, and 11 ± 8 µmol/L, respectively; Bonferroni corrected P < 0.01). The differences were significant even after adjustment for several potential confounders, as illustrated in Table 2Go. Moreover, the interaction of sex and MTHFR genotype on tHcy was highly significant (F test = 12.4, P = 0.001). However, when we compared T allele carriers (ie, we combined TT homozygotes and CT heterozygotes) with non-T-allele carriers (ie, CC homozygotes), we found no significant differences in tHcy concentrations (men: 12 ± 7 compared with 12 ± 8 µmol/L, P = 0.89, and women: 12 ± 7 compared with 9 ± 7 µmol/L, P = 0.06). This last result agrees with the results presented in Table 2Go and emphasizes the effect of TT homozygosity on tHcy concentrations.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Results from regression models that evaluated the association between total plasma homocysteine concentrations (µmol/L) and methylenetetrahydrofolate reductase (MTHFR) genotype in men and women1

 
Homocysteine concentrations, Mediterranean diet, and MTHFR genotype
No significant differences in diet score were observed between the MTHFR genotype groups (CC: 36 ± 12; CT: 35 ± 11; and TT: 37 ± 14; P = 0.95). Moreover, the diet score was not significantly associated with tHcy concentrations in either men (rho = –0.04, P = 0.91) or women (rho = –0.08, P = 0.71). However, when we stratified our analysis by MTHFR genotype, we found that the diet score was significantly associated with lower tHcy concentrations in TT and CT individuals (standardized ß = –0.21, P = 0.002, and standardized ß = –0.14, P = 0.025, respectively) but not in CC individuals (standardized ß = –0.03, P = 0.38), after control for age, sex, physical activity status, years of school, annual income, pack-years of smoking, body mass index, systolic and diastolic blood pressures, glucose concentrations, total serum cholesterol concentrations, and coffee intake. These findings are illustrated in Figure 1Go. Additionally, the interaction term between diet and MTHFR genotype, which was included in the multivariate model, was highly significant (standardized ß = –0.47, P < 0.001). Moreover, a 10-unit increase in the diet score was associated with 4-µmol/L decrease in tHcy concentrations among TT participants and a 2-µmol/L decrease among CT participants, whereas no significant reduction was observed among CC individuals.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1.. Mediterranean diet scores and total plasma homocysteine concentrations in persons with the TT (n = 63; standardized ß = –0.21, P = 0.002), CT (n = 276; ß = –0.14, P = 0.025), and CC (n = 235; ß = –0.03, P = 0.38) methylenetetrahydrofolate reductase (MTHFR) 667C->T genotypes. The diet score x MTHFR genotype interaction was significant, P = 0.001.

 
Intake of fruit and vegetables, but not meat consumption, was inversely associated with tHcy concentrations in TT and CT participants (Table 3Go). Moreover, when we excluded fruit and vegetables from the diet score, we observed that the score was still significantly associated with lower tHcy concentrations in TT and CT participants but not in CC individuals (Table 3Go). The latter finding underlines the importance of the Mediterranean diet as a whole regarding the effect on tHcy concentrations after taking into account MTHFR genotype.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Results of regression models that evaluated the association between total plasma homocysteine concentrations (µmol/L) and diet score by methylenetetrahydrofolate reductase (MTHFR) genotype in men and women1

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To the best of our knowledge, ours is the first study to assess the relation between the MTHFR polymorphism and a Mediterranean diet on tHcy concentrations. We found that a 10-unit increase in the diet score (meaning a diet closer to a Mediterranean one) was associated with a 4-µmol/L decrease in tHcy concentrations among TT homozygotes and a 2-µmol/L decrease among CT heterozygotes but no significant reduction among CC homozygotes. That finding was still significant even when we excluded fruit and vegetable consumption from the diet score.

High tHcy concentrations are now believed to be directly related to the development of occlusive vascular disease (13). Both prospective and case-control studies indicate that elevated plasma tHcy concentrations precede the development of disease and that this is a dose-response effect (18). In particular, it has been reported that a 5-mmol/L increase in plasma tHcy is associated with the same increase in risk of coronary artery disease as is a 20-mg/dL increase in the serum cholesterol concentration (19). However, some unclear results of prospective studies have been attributed to small sample sizes or measurement error for tHcy concentrations (18). In addition, the 677C->T mutation in the enzyme MTHFR has been associated with increased plasma tHcy concentrations (912). At this point, we should note that there are studies that report that the association between MTHFR genotype and tHcy concentrations or coronary risk may be influenced by various dietary or environmental factors. For example, Chambers et al (20) reported that the MTHFR 677 T allele does not contribute to increased tHcy concentrations or coronary risk in Indian Asians, unlike in US, European, and other white populations (912, 21, 22). This was partially explained by the low folate and vitamin B-12 concentrations in Indian Asians.

The most common cause of mildly elevated tHcy concentrations is a deficiency in some nutrients that regulate tHcy metabolism. Several investigators have reported a lowering effect of folic acid and vitamins B-6 and B-12 on tHcy concentrations (2325). For example, dietary supplementation with folic acid is associated with reductions in the plasma tHcy concentration of {approx}30% in almost all subjects (24). TT homozygotes require higher folate intakes than do subjects with the CT or CC genotype to achieve similar tHcy concentrations (26).

The cardioprotective effect of a Mediterranean diet was previously shown (27). In patients recovering from myocardial infarction and who were adapted to a Cretan Mediterranean diet, recurrent myocardial infarction, all cardiovascular events, and cardiac and total death significantly decreased. Higher consumption of fruit and legumes (which have a pivotal role in the Mediterranean diet) reduces tHcy concentrations in men (28). We showed, however, that the effect of the MTHFR gene–Mediterranean diet interaction on tHcy concentrations was independent of fruit and vegetable consumption, which thus implies that other foods in the Mediterranean diet model may play a more important role in the reduction in tHcy.

Limitations
Our study has some limitations. Because it was a cross-sectional survey, we cannot imply causal relations but can only state hypotheses. Another limitation is that we took into account folate and vitamin B-12 concentrations indirectly, through the food groups consumed by the participants and not by blood serum measurements.

Conclusion
In a population-based sample of cardiovascular disease–free men and women from Greece, we showed the effect of the MTHFR gene–Mediterranean diet interaction on tHcy concentrations to be independent of fruit and vegetable consumption. This suggests that adherence to this traditional diet may reduce tHcy concentrations and consequently influence coronary risk in high-risk individuals.


    ACKNOWLEDGMENTS
 
We thank the field investigators of the ATTICA study [John Skoumas (principal field investigator), Natasa Katinioti (physical examination), Spiros Vellas (physical examination), and Efi Tsetsekou (physical/psychological evaluation)] and the technical team [Marina Toutouza (senior investigator and biochemical analysis), Manolis Kambaxis (nutritional evaluation), Konstadina Paliou (nutritional evaluation), Chrysoula Tselika (biochemical evaluation), Sia Poulopoulou (biochemical evaluation), and Maria Toutouza (database management)].

GVD performed the genetic analysis and evaluation and edited the manuscript; DBP designed and supervised the study, performed the data analysis and the interpretation of the results, and drafted the manuscript; CC designed and supervised the clinical evaluation of the study, had the original idea, and drafted the manuscript; CP designed and supervised the study and edited the manuscript; AZ performed the dietary evaluation and edited the manuscript; DC contributed to the genetic analysis; and CS drafted the manuscript. None of the authors had a conflict of interest.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ganji V, Kafai MR. Third National Health and Nutrition Examination Survey. Demographic, health, lifestyle, and blood vitamin determinants of serum total homocysteine concentrations in the third National Health and Nutrition Examination Survey, 1988–1994. Am J Clin Nutr 2003;77:826–33.[Abstract/Free Full Text]
  2. Nygard O, Vollset SE, Refsum H, et al. Total plasma homocysteine and cardiovascular risk profile. The Hordaland Homocysteine Study. JAMA 1995;274:1526–33.[Abstract]
  3. Graham IM, Daly LE, Refsum HM, et al. Plasma homocysteine as a risk factor for vascular disease. The European Concerted Action Project. JAMA 1997;277:1775–81.[Abstract]
  4. Brattstrom L, Wilcken DE. Homocysteine and cardiovascular disease: cause or effect? Am J Clin Nutr 2000;72:315–23.[Abstract/Free Full Text]
  5. Tsiara S, Elisaf M, Mikhailidis DP. Influence of smoking on predictors of vascular disease. Angiology 2003;54:507–30.
  6. Van Oort FV, Melse-Boonstra A, Brouwer IA, et al. Folic acid and reduction of plasma homocysteine concentrations in older adults: a dose-response study. Am J Clin Nutr 2003;77:1318–23.[Abstract/Free Full Text]
  7. Alfthan G, Pekkamen J, Janhiainen M. Relation of serum homocysteine and lipoprotein(a) concentrations to atherosclerotic disease in a prospective Finnish population based study. Atherosclerosis 1994;106:9–19.[Medline]
  8. Knekt P, Reunanen A, Alfthan G, et al. Hyperhomocysteinemia: a risk factor or a consequence of coronary heart disease? Arch Intern Med 2001;161:1589–94.[Abstract/Free Full Text]
  9. Frosst P, Blom HJ, Milos R, et al. A candidate genetic risk factor for vascular disease: a common mutation in methynetetrahydrofolate reductase. Nat Genet 1995;10:111–3.[Medline]
  10. Gundnasson V, Stansbie D, Scott J, et al. C677T polymorphism in methylenetetrahydrofolate reductase (MTHFR): its frequency impact on plasma homocysteine concentration in different European populations: EARS group. Atherosclerosis 1998;136:347–54.[Medline]
  11. Brattstrom L, Wilcken DE, Ohrvik J, Brudin L. Common methylenetetrahydrofolate reductase gene mutation leads to hyperhomocysteinemia but not to vascular disease: the result of a meta-analysis. Circulation 1998;98:2520–6.[Abstract/Free Full Text]
  12. Jacques PF, Bostom AG, Williams RR, et al. Relation between folate status, a common mutation in methylenetetrahydrofolate reductase, and plasma homocysteine concentrations. Circulation 1996;93:7–9.[Abstract/Free Full Text]
  13. Kushi LH, Lenart EB, Willett WC. Health implications of Mediterranean diets in light of contemporary knowledge. 1. Plant foods and dairy products. Am J Clin Nutr 1995;61(suppl):1407S–15S.[Abstract]
  14. Povey S, Lovering R, Bruford E, Wright M, Lush M, Wain H. The HUGO Gene Nomenclature Committee (HGNC). Hum Genet 2001;109:678–80.[Medline]
  15. Pitsavos C, Panagiotakos DB, Chrysohoou C, Stefanadis C. Epidemiology of cardiovascular risk factors, in Greece: aims, design and baseline characteristics of the ATTICA study. BMC Public Health 2003;3:32.[Medline]
  16. Fiskerstrand T, Refsum H, Kvalheim G, Ueland PM. Homocysteine and another thiols in plasma and urine: automated determination and sample stability. Clin Chem 1993;39:263–71.[Abstract]
  17. Willett WC, Sacks F, Trichopoulou A, et al. Mediterranean diet pyramid: a cultural model for healthy eating. Am J Clin Nutr 1995;6(suppl):1402S–6S.
  18. Stampfer MJ, Manilow R, Willett WC, et al. A prospective study of plasma homocysteine and risk of myocardial infarction in US physicians. JAMA 1992;268:877–81.[Abstract]
  19. Boushey C, Beresford SAA, Omenn G, et al. A quantitative assessment of homocysteine as a risk factor for vascular disease. Probable benefits form increasing folate intakes. JAMA 1994;274:1049–57.
  20. Chambers J, Ireland H, Thompson E, et al. Methylenetetrahydrofolate reductase C677T mutation and coronary heart disease risk in UK Indian Asians. Arterioscler Thromb Vasc Biol 2000;20:2448–52.[Abstract/Free Full Text]
  21. Ma J, Stampfer HJ, Hennekens CH, et al. Methylenetetrahydrofolate reductase polymorphism, plasma folate, homocysteine and risk of myocardial infarction in US physicians. Circulation 1996;94:2410–6.[Abstract/Free Full Text]
  22. Schmitz C, Lindpaintner K, Verhoef P, et al. Genetic polymorphism of methylenetetrahydrofolate reductase and myocardial infarction: a case-control study. Circulation 1996;94:1812–4.[Abstract/Free Full Text]
  23. Joosten E, van den Berg A, Reizler R, et al. More evidence that deficiencies of vitamin B-12 (cobalamin), folate and vitamin B-6 occur commonly in elderly people. Am J Clin Nutr 1993;58:468–76.[Abstract/Free Full Text]
  24. Kuller LH, Evans RW. Homocysteine, vitamins, and cardiovascular disease. Circulation 1998;98:196–9.[Free Full Text]
  25. Herrmann W, Obeid R, Schorr H, Zarzour W, Geisel J. Homocysteine, methylenetetrahydrofolate reductase C677T polymorphism and the B-vitamins: a facet of nature-nurture interplay. Clin Chem Lab Med 2003;41:547–53.[Medline]
  26. Ashfield-Watt PA, Pullin CH, Whiting JM, et al. Methylenetetrahydrofolate reductase 677C->T genotype modulates homocysteine responses to a folate-rich diet or a low-dose folic acid supplement: a randomized controlled trial. Am J Clin Nutr 2002;76:180–6.[Abstract/Free Full Text]
  27. Renaud S, de Lorgeril M, Delaye J, et al. Cretan Mediterranean diet for prevention of coronary heart disease. Am J Clin Nutr 1995;61(suppl):1360S–7S.[Abstract]
  28. Samman S, Sivarajah G, Man JC, Ahmad ZI, Petocz P, Caterson ID. A mixed fruit and vegetable concentrate increases plasma antioxidant vitamins and folate and lowers plasma homocysteine in men. J Nutr 2003l;133:2188–93.[Abstract/Free Full Text]
Received for publication January 20, 2004. Accepted for publication April 2, 2004.




This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. M. Ulrich, M. Neuhouser, A. Y. Liu, A. Boynton, J. F. Gregory III, B. Shane, S. J. James, M. C. Reed, and H. F. Nijhout
Mathematical Modeling of Folate Metabolism: Predicted Effects of Genetic Polymorphisms on Mechanisms and Biomarkers Relevant to Carcinogenesis
Cancer Epidemiol. Biomarkers Prev., July 1, 2008; 17(7): 1822 - 1831.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. C. Reed, H. F. Nijhout, M. L. Neuhouser, J. F. Gregory III, B. Shane, S. J. James, A. Boynton, and C. M. Ulrich
A Mathematical Model Gives Insights into Nutritional and Genetic Aspects of Folate-Mediated One-Carbon Metabolism
J. Nutr., October 1, 2006; 136(10): 2653 - 2661.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. Papoutsakis, N. Yiannakouris, Y. Manios, E. Papaconstantinou, F. Magkos, K. H. Schulpis, A. Zampelas, and A. L. Matalas
Plasma Homocysteine Concentrations in Greek Children Are Influenced by an Interaction between the Methylenetetrahydrofolate Reductase C677T Genotype and Folate Status
J. Nutr., March 1, 2005; 135(3): 383 - 388.
[Abstract] [Full Text] [PDF]


Home page
BMJHome page
Minerva
BMJ, October 16, 2004; 329(7471): 926 - 926.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dedoussis, G. V
Right arrow Articles by Stefanadis, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dedoussis, G. V
Right arrow Articles by Stefanadis, C.
Agricola
Right arrow Articles by Dedoussis, G. V
Right arrow Articles by Stefanadis, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS